Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

Java Mulakat Sorulari – İleri Seviye

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir.

Bu makalemde sizlere ileri seviye java bilgilenizi test edebileceksiniz, ayni zamanda daha onceden hic duymamis oldugunuz bir kavram ile de bu ilginc basliklar arasinda karsilasabilir ve boylelikle kendinize bir arti daha katmis olabileceksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

Java Mulakat Sorulari

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir. Bu makalemde sizlere kendi yeteneginizide test edebileceginiz; nesne yönelimli programlama ve özellikleri, Java ve işlevselliğine ilişkin genel sorular, Java koleksiyonları, çöp toplayıcıları, istisna işleme, Java uygulamaları, Swing, JDBC, Uzak Metot Çağrımı (RMI), Servlet ve yaklaşık görüşecek JSP konularinda genel kultur olabilecek bazi mulakat sorular bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

Java ile Satranc Oyunu

Gönderim Ağustos 16th, 2014

javaBu makalede, Java’da oyun programlama yonunuzu gelistirebileceginiz bir uygulamanin kodlarini paylasiyor olucam.

Internet ortaminda da buna benzer bir cok oyun programlama orneklerini bulup kendinizini daha iyi bir sekilde gelistirebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java Desktop App ile Local Sequence Alignment

Gönderim Temmuz 7th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in Java Desktop Application ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini ve java desktop application orneklerini iyi bir sekilde pekistirmis olabileceksiniz. Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Multiple Sequence Alignment (4D)

Gönderim Mayıs 27th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (4 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | 2 Yorum »

Java ile Multiple Sequence Alignment (5D)

Gönderim Mayıs 26th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (5 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Local Sequence Alignment

Gönderim Mayıs 17th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Protein Dizisi Hizalama

Gönderim Mayıs 5th, 2014

Bu makalemde basit bir mantikla protein zincirlerlerinde hizalamalari java yardimiyla eslestirmeye calisicaz.

Yapilan bu calisma ile ayni zamanda java’da string kontrollerini pekistirmis olucaksiniz.

Calisma sonucunda ornek olarak kullanabileceginiz protein dizilimleride bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Blosum62 Hesaplama

Gönderim Nisan 25th, 2014

Biyoinformatik alaninda protein dizilerinin hesaplanmasi konusu onemlidir ve dikkatlice yapilmasi gerekir. Dizi hizalamanin en onemli gorevi farkli DNA, RNA veya protein dizilimlerinin birbirine en cok benzer alanlarinin tespit edilmesidir. Dizi hizalamarinda temel yaklasim olarak hesaplama islemleri puanlama sistemine dayanmaktadir. Bunun icin en cok kullanilan algoritmanin BLAST oldugunu soyleyebilirim. Yapmis oldugum uygulamada, en basit seklinde bir Protein diziliminin hesaplamasi icin BLOSUM62 yontemini kullaniyor olucaz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java String Kontrolleri

Gönderim Nisan 2nd, 2014

java Bu yazimda sizlere java’da kullanilan bazi string kontrollerinden bahsediyor olucam.

Onceden belirlemis oldugunuz string’in belirli baslangic ve sonuc indexleri tanimlandiktan sonra string icerisinden o ifadeyi nasil cekebilecegimizi gorucez. Bu islemleri gerceklestirirken ornegimizde  indexOf ve substring kontrollerinin kullanisi hakkinda bilgi sahibi olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java MySql Connection

Gönderim Nisan 1st, 2014

javamysql Bu makalerde, Java – MySql veri tabanina baglanti yapabilmek icin gerekli olabilecek java kodlarindan bahsediyor olucam.

Bu islemi yaparken sql cumlenizi baglantiyla ilgili metoda gondererek daha rahat bir sekilde yapabileceksiniz. Ayni zamanda try-catch blogunu kullanarak islem sureclerinde hataya yakalanip yakalanmadiginizi kontrol edebiliyor olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java Web – Canvas Derleyicisi

Gönderim Haziran 23rd, 2013

Java web uygulamasi uzerinde basit bir turkce icerikli canvas derleyicisi hazirlayalim. Bunun icin jsp ile iletisimde kalabilecek bir java class’ina ihtiyacimiz bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Web Uygulamalarinda Canvas

Gönderim Haziran 23rd, 2013

Html5 Canvas uygulamalarinin web sayfalarinizda grafik cizimleri icin kullanabileceginizi biliyorsunuzdur. Canvas cizimlerinizi <canvas > </canvas> taglari arasinda kullanarak gerceklestirebilirsiniz. Bununla birlikte size javaScript’te yardim olacaktir. Peki bunu jsf, jsp gibi java web application’larinizda nasil kullanacaksiniz basit bir ornekle gosterelim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Thread Uygulamasi

Gönderim Mayıs 31st, 2013

Java’da hem thread sinifini hemde runnable sinifini kullanarak bir uygulama paylasiyor olacagim.

Thread sinifindan extend edilmis ve runnable sinifindan implement edilmis siniflar icerisinde run method’larina vermis oldugumuz komutlari, Test sinifinda olusturulan nesnelerin Start methodlari ile thread’leri cagiriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

Thread Sinifi Method’larinin Kullanimi ve Uygulamalari

Gönderim Mayıs 31st, 2013

Aslinda her iki yontemle de ayni seyleri yapiyoruz fakat farkli iki yol kullaniyoruz. Thread sinifindan uretmis oldugumuz nesne sayesinde Thread yasam dongusundeki rolune tamamen hakim olmaktadir. Runnable ise bir arabirim gibi kullanilmaktadir. Sadece bir thread tanimlanir ve o thread uzerinde isler yurutulur fakat tum kontrole hakim olamaz. Diger onemli bir konu ise,

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

MultiThreaded Programming With JAVA

Gönderim Mayıs 31st, 2013

Java’da Thread’ler object olarak bulunmaktadir. Iki farkli yontemle thread’ler uzerinde calisabiliriz.

1. Standart sinifimizi Thread sinifindan extend ederek.

2. Standart sinifimizi Runnable interface’inden implement ederek.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

Oracle Java Cloud Service Uygulamasi

Gönderim Nisan 30th, 2013

Bir onceki Oracle Cloud Computing yazisinda bahsettigim gibi JDeveloper Oracle Cloud icin gelistirmis oldugu surumu olan Oracle JDeveloper 11g ( ile kucuk bir uygulama gelistirip bunu oracle cloud ortamina nasil deployment edecegimizi yazalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Bulut Bilisim, Java, Oracle, Web Programlama, Yazilim | Yorum Yok »

Oracle Cloud Computing Hakkinda

Gönderim Nisan 29th, 2013

Bulut bilisim konusundaki arastirmalarima devam ederken bu kez solugu Oracle Cloud Computing’de aldim. Bu makalem ve ilerleyen makalelerimde Trial versiyonu ile user tarafini pek yormayan bir yapidan bahsediyor olacagim. Daha cok Java Developer’larin ilgisini cekecek olan bu yapi gun gectikce kendini gelistirmeye devam ediyor.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Bulut Bilisim, Java, Oracle, Yazilim | Yorum Yok »

Selenium – Python,Ruby,Java ve CSharp Donusumleri

Gönderim Mart 30th, 2013

Selenium’un bize HTML formatinda hazirlamis oldugu test case’leri Python, Ruby, Java ve CSharp dillerinde kullanabilecegimiz test case’lere nasil donusturecegimizi inceleyecegiz. En bastan beri kullanmis oldugum ornek uygulama uzerinden gidelim ve donusumleri nasil yaptigimizdan adim adim bahsetmeye baslayalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Python, Selenium, TDD - Test Driven Development, Yazilim | Yorum Yok »

TDD – JUnit Kullanimi [Eclipse]

Gönderim Mart 30th, 2013

Bu makalem ile size onceki yazimda Java’nin kullandigi Test Unit Framework olan JUnit’ten bahsetmistim. Hairlarsaniz, Netbeans arayuzu ile birlikte bir uygulama gerceklestirmistim. Simdi ise Eclipse arayuzunde JUnit kullanimi adim adim anlatabilmek adina basit bir uygulama gerceklestiriyor olacagim. Oncelikle JUnit Framework’unu indirebilmeniz icin sitesini ziyaret etmeniz ve jUnit4.0 icin yayinlanmis olan jar’lardan guncel olan versiyonunu indiriyoruz. Ardindan Eclipse Ide’mizi calistiriyoruz ve Yeni bir Java Project ile uygulamamizi gelistirmeye basliyorouz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, TDD - Test Driven Development, Yazilim | Yorum Yok »

TDD – JUnit Kullanimi [Netbeans]

Gönderim Şubat 6th, 2013

Bu makalem ile size onceki TDD yazilimda bahsetmis oldugum, Java’nin kullandigi Test Unit Framework olan JUnit’ten bahsedip bir de basit bir uygulama gerceklestiriyor olacagim. Uygulamalarimizi NetBeans arayuzunde gerceklestiriyor olacagim. Java Application olarak yeni bir proje olusturuyor ve ismini JUnitPersonelUygulamasi olarak duzenliyorum. Olusturdugumuz projeye Libraries kisminda Junit framework’u ile ilgili olan JUnit4.10 ile ilgili jar’i tanitiyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, TDD - Test Driven Development, Yazilim | Yorum Yok »

TDD – Test Driven Development Komutlari

Gönderim Şubat 6th, 2013

TDD hakinda en sik kullanilan ve bilinmesi gereken bazi terimlerden bahsediyor olacagim bu yazimda. Uygulamalar esnasinda da farkli terimlerle karsilastigimizda kullanim sekillerinden bahsediyor olacagim. Simdilik NUnit ve JUnit icin kullanilan komutlardan sirasiyla bahsedelim. Ardindan bu framework’leri nereden indirecegimize bakalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Java, TDD - Test Driven Development, Visual Studio, Yazilim | Yorum Yok »

TDD – Test Driven Development

Gönderim Şubat 6th, 2013

Merhabalar, Test Driven Development – Test Gudumlu Yazilim’la ilgili merakim her zaman olmustur. Bu merakim sonucu yapmis oldugum arastirmalarla ilgili kucuk ama onemli ayrintilari artik vakit buldukca sizlerlede paylasmayi dusunuyorum. Calismalarimda gunumuzde kullanilan her onemli iki dilde de yapiyor olacagim; Java ve C Sharp. Bunlara ait olan Test Unit’lerinde nasil kullanildigini adim adim anlattiktan sonra da anlasilir orneklerlede olayi ozetliyor olacagim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, TDD - Test Driven Development, Visual Studio, Yazilim | Yorum Yok »

Bulanik Mantik Motor Performans Uygulamasi [Java]

Gönderim Kasım 19th, 2012

Bu makale iceriginde Suleyman Demirel Universitesi – Bilgisayar Muhendisligi bolumu’nun Yapay Zeka dersi icin gelistirilen Bulanik Mantik uygulamasinin Java’nin JSF ozelligi ile yapilmis bir ornegini paylasiyor olacagim. Bir sonraki makalemde ise .Net uzerindeki yapilmis hali ve icerisine katmis oldugumuz grafiksel ozellikleride paylasiyor olacagim. Bunun icin oncelikle uygulamamiz icin gerekli problemi inceleyelim, hemen ardindanda kaynak kodlarini inceleyelim…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yapay Zeka, Yazilim | Yorum Yok »

Windows Azure Platformunda Java Uygulamalari

Gönderim Eylül 14th, 2012

Windows Azure’u bugune kadar aliskanlik olarak surekli Visual Studio ortaminda anlattik. Ilk baslarda dedigimiz gibi Windows Azure bircok platforma destek vermektedir. Peki .Net haricinde farkli bir dunya olan Java tarafinda isler nasil yuruyor bunlari arastirmak istedim. Bu makalemde Windows Azure platformunda Java’yi  inceledikten sonra yine her zamanki gibi basit bir uygulama ile noktamizi koyuyor olacagiz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Sistem, Web Programlama, Windows Azure, Yazilim | Yorum Yok »

Java – Uploader Kullanimi

Gönderim Haziran 7th, 2012

Java’da web projelerinizde upload islemlerinizi gerceklestirebilmeniz icin Uploader ozeligine ait librariyleri uygulamaniza eklemeniz ve ilgili kodlarini yazmaniz yeterli olacaktir.

Uygulamamizi gerceklestirebilmemiz icin oncelikle Netbeans’de bir web application’i olusturuyoruz. Olusturulan application’in source packages kisminda yeni bir paket olusturup icerisine bir java class’i aciyoruz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java – iReport Kullanimi

Gönderim Haziran 7th, 2012

Java’da verilerinizi kendi tasarladiginiz raporlar kullanalabilmeniz icin projenize ekleyeceginiz library ve plug-in ‘ler sayesinde projelerinizi daha kullanabilir hale getirebilirsiniz.

Bunun icin oncelikle iReport ismi verilen plug-in i kullandiginiz arayuzunuz icin download edip, IDE’nize yuklemelisiniz. Kullandigim IDE, Netbeans oldugu icin; Netbeans in kendi sitesinde bulunan plug-in menusunden download edebilirsiniz.

iReport Linki ;

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Web Service ve Web Service Client Olusturma

Gönderim Mayıs 10th, 2012

Java Web Service ve Java Web Service Client olusturmalari ile ilgili bu uygulamayi adim adim gerceklestiriyor olacagiz. Uygulamamizda cektigimiz veriye ait diger bilgileri listelettirme islemlerini gerceklestiricez.

Bunun icin database’imizden verileri aktarabilmemiz ve yine bu verileri kullanicilara sunabilmemiz icin yine jsf yapisindan yararlaniyor olacagiz.

Oncelikle Netbeans arayuzumuzde Web_Service_Uygulamalari isminde  yeni bir web application olusturalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Sistem, Web Programlama, Yazilim | Yorum Yok »

JSP Servlet ile JSON Uygulamasi

Gönderim Mayıs 8th, 2012

Bu makalemde JSon yapisindan biraz bahsettikten sonra hemen ardindan Oracle veri tabaninda ki verilerimi Java’da Bean siniflari kullanarak web ortaminda JSP formati ile kullaniciya verilerimizi sunucam.

Oncelikle JSon’dan bahsedecek olursak…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Oracle, Web Programlama, Yazilim | Yorum Yok »

Java – Assembly Derleyecisi

Gönderim Mayıs 8th, 2012

Asm komutlarini okuyup derleyebilen, hatali kodlarda kullaniciya hatali bilgi mesaji verebilen Java tarafinda gorsel arayuz kullanarak gelistirmis oldugumuz bir derleyicidir. Hashmap icin guzel bir ornek olabilecegini dusunuyorum…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Genel, Java, Yazilim | Yorum Yok »

JPA – Java Persistence API Kullanimi

Gönderim Nisan 7th, 2012

Bu makele ile birlikte NetBeans IDE ortaminda nasil rahat bir sekilde Java Persistence API kullaniliyor bunu anlatacagim.

Java Persistence Api’ler JPA olarak anilmaktadir. JPA en son olarak JPA2.0 olarak anildigindan dolayi icerisinde barindirdigi konular vardir. Bunlar ; API’nin kendi tanimlamis oldugu javax.persistence package’ , Java Persistence Query Language(LPQL), nesneler arasi iliskiler olusturmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

NetBeans – Uml Plug-In Sorunu

Gönderim Mart 26th, 2012

Merhabalar, bildiginiz uzere NetBeans IDE ‘nin son surumlerinde UML plug-in’i ya hatali calisiyor ya da hic bu plug-in yuklenmiyor. Veya yaptiginiz UML’leri sisteminize kaydettiginizi sandiginizda yeniden calistirdiginizda Uml Project’inizi bulamiyorsunuz. Bug’siz veya duzgun bir sekilde calisan ve son surumlerine yakin olan bir tek surumu NetBeans IDE 6.1’dir diyebiliriz.

Peki sisteminizde NetBeans’in son surumu varken Uml Plug-in’i nasil kullanibiliriz sorusuna gelince, biraz mesakatli’de olsa ufak bir cozum yolumuz var tabikide…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: ,
Bulundugu Konu Basliklari Java, Sistem, Yazilim | Yorum Yok »

JSF Ile Veri Silme

Gönderim Mart 26th, 2012

Onceki makalelerde JSF  ve kullandigi bilesenlerden bahsettik. Ve bununla birlikte verilerimizi nasil listeleyebildigimizi, yeni verileri nasil ekleyebilecegimizi, bunlar uzerinde nasil duzenlemeler yapabilecegimizi incelemistik. Son olarak verilerimizi nasil silecegimizden bahsedecegim.

Bir onceki makalede olusturdugumuz uygulamanin uzerinden devam edecek olursak bu kez yine oncelikle java class’larimizi olusturmakla ise basliyoruz. Hemen ardindan faces-config.xml dosyamiza iletisimi saglayacak kodlari ve son olarakta JSF sayfamizin tasarimini gerceklestiriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

JSF Ile Veri Guncelleme

Gönderim Mart 26th, 2012

Onceki makalelerde JSF  ve kullandigi bilesenlerden bahsettik. Ve bununla birlikte verilerimizi nasil listeleyebildigimizi ve yeni verileri nasil ekleyebilecegimizi inceledik. Sira geldi daha onceden var olan verilerimizin yeniden duzeltilmesi olayina.

Bir onceki makalede olusturdugumuz uygulamanin uzerinden devam edecek olursak bu kez yine oncelikle java class’larimizi olusturmakla ise basliyoruz. Hemen ardindan faces-config.xml dosyamiza iletisimi saglayacak kodlari ve son olarakta JSF sayfamizin tasarimini gerceklestiriyoruz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

JSF Ile Veri Ekleme

Gönderim Mart 26th, 2012

Onceki makalelerde JSF  ve kullandigi bilesenlerden bahsettik.Ve bununla birlikte verilerimizi nasil listeleyebildigimizi inceledik. Sira geldi JSF ile verilerimizi veri tabanina nasil aktaracagimiza…

Bir onceki makalede olusturdugumuz uygulamanin uzerinden devam edecek olursak bu kez yine oncelikle java class’larimizi olusturmakla ise basliyoruz. Hemen ardindan faces-config.xml dosyamiza iletisimi saglayacak kodlari ve son olarakta JSF sayfamizin tasarimini gerceklestiriyoruz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

JSF, JSF Bilesenleri ve Bean Kavramlari

Gönderim Mart 25th, 2012

JavaServer Faces (JSF) ile daha onceden bahsettigimi jsp ve servlet’lerimizinden biraz daha farkli olarak calisan, arka planda Servlet ve kullanici tarafinda ise Jsp’lerin bilesenlerinin kullanildigi ve temeli MVC olan bir yapidir. Aslinda bir nevi arka planda calisan, kodlari, tasarimlari, bilesenleri ve gorunumleri ile olsu ayri ayri islemleri gerceklestirebilecegimiz bir Framework olarak tanimlayabiliriz.

Bu makalemizde JSF’ nin kendi ortami icin kullanilan bilesenlerden bahsediyor olacagim. Ilerleyen makalelerde de bunlarla ilgili CRUD islemlerinin yer aldigi veri tabanlari ile ilgili iletisimlerini gosterebilecegim bir uygulamayi adim adim anlatiyor olacagim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

JSF Ile Verileri Listeleme

Gönderim Mart 25th, 2012

Java Server Faces (JSF), Java tabanli web uygulamalarini kolaylastirmak icin MVC mimarisini yani Model View Controller mimarisini uygun bir sekilde kullanarak gelistirilmis bir framework’tur.

JSF, guclu ve dinamik web uygulamalari gelistirmeyi kolaylastiran web tabanli ara yuzler hazirlamak icin tasarlanmistir. Tipki Java Swing gibi standart bilesenlere sahiptir ve bu bilensenleri kullanirkende kendi API’sinden faydalanmaktadir. Java icin bircok web ara yuz uygulama catisi bulunmasina karsin Java Server Faces Java API olmasi ile one cikmaktadir. Jsf’le tasarim yaparken, java bean bilesenlerini kullanarak web arayuzu tasarlamamizda islerimizi kolaylastiracaktir.

Dilerseniz JSF hakkinda kisa bir ozet gectikten sonra JSF kullanarak Veritabanimizdan verilerimizi nasil cekip listeleyebilecegimizi asama asama gerceklestirelim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Jsp ve Sevlet’da Bean Kullanim Uygulamasi

Gönderim Mart 22nd, 2012

Bu makelemde Jsp ile birlikte Servlet’leri kullanarak Veri Tabanimiza bilgi nasil ekleyip listeleyebilecegimizi basit bir uygulama ile anlatmak istiyorum.

Uygulama icin kullanacagimiz server; GlassFish Server V3.x olacaktir.

Hemen ardindan da Netbeans IDE derleyici ortaminda bulunan Services ortamina kullanacagimiz veri tabanini ekliyoruz veye olusturuyoruz.

Servlet icerisinde doPost metodunu override ederek islemlerimizi gerceklestiricez.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Servlet – Session Kavrami

Gönderim Mart 7th, 2012

Bu makalemizle Java Servlet’te Session kavramini uygulamalarla birlikte inceleyecegiz.

Session yontemi ; User’larin bulunduklari sistemlerde aktif olduklari muddetce verileri tasiyabilirler. Istemciden gonderilen veriler sunucular tarafindan karsilanir. Herbir user’in verilerini ayri ayri tutabilmesi icin SessionId kullanmaktadir. Kullanicilarin actiklari bu oturumlarin surelerini belirleyebilmemiz icin Web.Xml konfigurasyon dosyasini kullanmamiz ve icerisine kodlar yazmamiz yeterli olacaktir. Default sure 30’dur.

Uygulamamiza gecmeden once var olan projemizde yeni bir servlet sinifi olusturuyoruz. Ve ismini KullaniciGirisServlet veriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Servlet – ServletContext Kavrami

Gönderim Mart 7th, 2012

Bu makalemizle Java Servlet’te ServletContext kavramini uygulamalarla birlikte inceleyecegiz.

ServletContext yontemi ; Web uygulamalarinda Javax.Servlet.ServletContext arayuzune ait bir servlet olarak temsil eder. Bu arayuz sayesinde, web uygulama kaynaklarinin olusturdugu verileri ortak bir mekanizma sayesinde veri akisina uyacak seklinde duzenler. Ortak bir veri akisini saglayabilmesi icinde uygulama icerisindeki tum degiskenlere erismesi gerekiyor, bu sebeplede ServletContext arayuzu kullanilmaktadir.

Uygulamamiza gecmeden once var olan projemizde yeni bir servlet sinifi olusturuyoruz. Ve ismini KontrolServlet02 veriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Servlet – Dispatcher Kavrami

Gönderim Mart 6th, 2012

Bu makalemizle Java Servlet’te RequestDispatcher kavramini uygulamalarla birlikte inceleyecegiz.

RequestDispatcher yontemi ; istek aninda baska jsp yada servlet sayfalarini yonlendirmek icin kullanilir. Java Servlet basit bir parametre ile birlikte aldigi web sayfasini, nitelikleri ile birlikte hedef sayfaya ulastiracaktir. Kisacasi bir servlet’ten diger servlet’e yonlendirilme olarakta soyleyebiliriz.

Uygulamamiza gecmeden once var olan projemizde yeni bir servlet sinifi olusturuyoruz. Ve ismini KontrolServlet veriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Servlet – Redirect Kavrami

Gönderim Mart 6th, 2012

Bu makalemizle Java Servlet’te SendRedirect kavramini uygulamalarla birlikte inceleyecegiz.

SendRedirect yontemi ; bir servlet tarafindan baska servlet’leri cagirabilmemiz icin kullanilabilmektedir. Istemci WebContainer’a gidip herhangi bir istegi redirect ile ceker. Container ilgili servlet’i istemciye sunucu araciligiyla gonderecektir. Tum bu yonlendirme islemleri sirasinda kullanicilar isleyisten habersizdir.

Uygulamamiza gecmeden once var olan projemizde yeni bir servlet sinifi olusturuyoruz. Ve ismini SeyfayaGitServlet veriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Bir Uygulama Ile Java Servlet Icerikleri…

Gönderim Mart 6th, 2012

Oncelikle NetBeans IDE arayuzumuzde Yeni bir proje olusturarak ; Java Web kategorilerinden proje turumuzu Web Application olarak seciyoruz. Projemize bir isim verdikten sonra ucuncu adimda server ve context path bilgilerini belirtiyoruz.

Server olarak GlashFish’de kullanilabilir. Uygulamalarim icin Apache Tomcat’i seciyorum. Context path kisminda olusturdugunuz proje isminin /’li ismini kendisi otomatik olarak vermektedir. Ileri butonu ile dorduncu adimda framework ayarlari gelmektedir. Finish butonu ile web application’imizi tamamlamis oluyoruz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Servlet Nedir?

Gönderim Mart 6th, 2012

Java Servlet’ler Java EE’de Java Servlet Api’leriyle uyumlu bir java sinifidir. Kullanim yerleri HTTP protokollerinden gelen istemlere yanit vermek icin kullanilmaktadir. Servlet’ler hakkinda bahsedilirken HttpServlet olarak bahsedildigini kodlarin icerisinde gorebilirsiniz. Servlet’ler ile calisirken HTTP cerezlerini veya URL’leri yeniden yazabileceginiz bir ortam sunacaktir.

Temel servlet paketleri, servlet istem ve yanitini sunan javanin uretmis oldugu nesnelerin yaninda servletin duzenlemis oldugu parametrelerini ve isletme cevresini de tanimlamaktadir. Web sunuculari ve istemcileri arasinda yollanan coklu istem ve yanitlari takip eden bir oturum yonetimi nesneleri de icine almaktadir. Yaptiginiz projelerin sonunda bir WAR dosyasi icerisinde servlet’lerinizi paketlendirebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Desktop Application’da Oracle Baglantilari

Gönderim Şubat 29th, 2012

Makele iceriginde Java Desktop Application’da Oracle baglantisini kurarak CRUD islemlerinin nasil gerceklestigini gorecegiz. Uygulamamizda, Arayuz olarak java icin NetBeans ve Oracle icinde 10g  Express Edition kullaniyorum.

Bilgisayarinizda kurulu olan Oracle Database 10g Express Edition programi ile birlikte yeni ve de uygulamamiz icin basit bir veri tabani tablosu olusturuyoruz.

Olusturacagimiz tablonun ismi tbl_elemanlar olarak belirledikten sonra, icerisinde personel_id, ad, soyad, gorev ve departman alanlarini olusturduk.

(Onceki makalelerde bunlarin nasil olusturuldugu anlatilmistir, lutfen inceleyiniz…)

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Java, Oracle, Yazilim | Yorum Yok »

Java’da Karar Agaclari – Linear Regression

Gönderim Ocak 23rd, 2012

Surekli degiskenlerin ongorusu regrasyon yani egri uydurma olarak adlandirilan bir istatistiksel yontemle tespit edilebilir. Regrasyon analizinin amaclari degisik girdi degiskenlerini cikti degiskeni ile iliskilendirecek en iyi modelin cikarilmasidir.

Bir Y degiskeninin diger bir veya daha cok X1, X2, … Xn, gibi degiskenleri ile iliskisinin belirlenmesi surecidir. Y , yanit ciktisi veya bagimli degisken olarak adlandirilir. Xi degiskenleri girdi ve bagimsiz degiskenler olarak adlandirilacaktir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Hibernate Uygulamasi

Gönderim Aralık 12th, 2011

Hibernate mimarisi daha onceki makalemde de bahsettigim gibi bir ORM araci olarak kullaniliyor. Object oriented’da bulunan nesnelerin veritabanlarinda ki iliskilerine karsilik gelen degerleri siniflandirabilecegimiz bir mimaridir. Bu mimarilerin en onemli faydasi, kod yazimini kisaltmak veya kolaylastirmaktan ziyade, yazilimin iyi bir sekilde dizayn edilmesi kolaylastirilmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da MVC, ORM, Hibernate Kavramlari

Gönderim Aralık 11th, 2011

MVC (Model View Controller)

Yazilim muhendisliginde kullandigimiz bir mimari yapisidir. Amac projelerimizde soyutlandirma yapabilmektir. Katmanlari paracalara ayirmaktir. Bol, Parcala, Yonet en bilinen amactir.

Bu modelin kullanilmasinin ihtiyac sebebi ise ; kalabalik bir tasarlanmis projeyi hem dizayn tarafindan hemde arka tarafdaki bazi kodlari tekrar tekrar yazdigimizda kod fazlaligi olusmaktadir. ilerki zamanlarda hata ciktiginda bunlari bulmak zaman alacagindan dolayi bu model gelistirilmis ve kullanilmaya baslamistir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java – Veri Madenciligi / SQL Viewer

Gönderim Aralık 8th, 2011

Bu uygulamamizda ODBC ile ayarladigimiz veri tabani dosyamizdan verilerimizi cekip sorgulamalarimizi yapicaz… Ayni zaman da null veriler varsa bunlari buldurtup kullanicidan veri girilip girilmeyecegini veya bu verilerin silinip silinmeyecegi hakkinda onay alacagiz.

Açık Veritabanı Bağlantısı (ODBC),

bir tür veritabanından (veri kaynağı) diğer tür veritabanına veri taşımak için kullanabileceğiniz bir teknolojidir. Bunun için doğru sürücüye gereksiniminiz vardır. Bu surucu ayarlarini da ODBC ayarlari ile yapmaktayiz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »


  • 4 Uye
  • 334 Yazi
  • 16 Yorum Var