Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

Java Mulakat Sorulari – İleri Seviye

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir.

Bu makalemde sizlere ileri seviye java bilgilenizi test edebileceksiniz, ayni zamanda daha onceden hic duymamis oldugunuz bir kavram ile de bu ilginc basliklar arasinda karsilasabilir ve boylelikle kendinize bir arti daha katmis olabileceksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

Java Mulakat Sorulari

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir. Bu makalemde sizlere kendi yeteneginizide test edebileceginiz; nesne yönelimli programlama ve özellikleri, Java ve işlevselliğine ilişkin genel sorular, Java koleksiyonları, çöp toplayıcıları, istisna işleme, Java uygulamaları, Swing, JDBC, Uzak Metot Çağrımı (RMI), Servlet ve yaklaşık görüşecek JSP konularinda genel kultur olabilecek bazi mulakat sorular bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

Java ile Satranc Oyunu

Gönderim Ağustos 16th, 2014

javaBu makalede, Java’da oyun programlama yonunuzu gelistirebileceginiz bir uygulamanin kodlarini paylasiyor olucam.

Internet ortaminda da buna benzer bir cok oyun programlama orneklerini bulup kendinizini daha iyi bir sekilde gelistirebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java Desktop App ile Local Sequence Alignment

Gönderim Temmuz 7th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in Java Desktop Application ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini ve java desktop application orneklerini iyi bir sekilde pekistirmis olabileceksiniz. Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Multiple Sequence Alignment (4D)

Gönderim Mayıs 27th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (4 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | 2 Yorum »

Java ile Multiple Sequence Alignment (5D)

Gönderim Mayıs 26th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (5 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Local Sequence Alignment

Gönderim Mayıs 17th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Protein Dizisi Hizalama

Gönderim Mayıs 5th, 2014

Bu makalemde basit bir mantikla protein zincirlerlerinde hizalamalari java yardimiyla eslestirmeye calisicaz.

Yapilan bu calisma ile ayni zamanda java’da string kontrollerini pekistirmis olucaksiniz.

Calisma sonucunda ornek olarak kullanabileceginiz protein dizilimleride bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Blosum62 Hesaplama

Gönderim Nisan 25th, 2014

Biyoinformatik alaninda protein dizilerinin hesaplanmasi konusu onemlidir ve dikkatlice yapilmasi gerekir. Dizi hizalamanin en onemli gorevi farkli DNA, RNA veya protein dizilimlerinin birbirine en cok benzer alanlarinin tespit edilmesidir. Dizi hizalamarinda temel yaklasim olarak hesaplama islemleri puanlama sistemine dayanmaktadir. Bunun icin en cok kullanilan algoritmanin BLAST oldugunu soyleyebilirim. Yapmis oldugum uygulamada, en basit seklinde bir Protein diziliminin hesaplamasi icin BLOSUM62 yontemini kullaniyor olucaz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java MySql Connection

Gönderim Nisan 1st, 2014

javamysql Bu makalerde, Java – MySql veri tabanina baglanti yapabilmek icin gerekli olabilecek java kodlarindan bahsediyor olucam.

Bu islemi yaparken sql cumlenizi baglantiyla ilgili metoda gondererek daha rahat bir sekilde yapabileceksiniz. Ayni zamanda try-catch blogunu kullanarak islem sureclerinde hataya yakalanip yakalanmadiginizi kontrol edebiliyor olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java Web – Canvas Derleyicisi

Gönderim Haziran 23rd, 2013

Java web uygulamasi uzerinde basit bir turkce icerikli canvas derleyicisi hazirlayalim. Bunun icin jsp ile iletisimde kalabilecek bir java class’ina ihtiyacimiz bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Web Uygulamalarinda Canvas

Gönderim Haziran 23rd, 2013

Html5 Canvas uygulamalarinin web sayfalarinizda grafik cizimleri icin kullanabileceginizi biliyorsunuzdur. Canvas cizimlerinizi <canvas > </canvas> taglari arasinda kullanarak gerceklestirebilirsiniz. Bununla birlikte size javaScript’te yardim olacaktir. Peki bunu jsf, jsp gibi java web application’larinizda nasil kullanacaksiniz basit bir ornekle gosterelim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java Thread Uygulamasi

Gönderim Mayıs 31st, 2013

Java’da hem thread sinifini hemde runnable sinifini kullanarak bir uygulama paylasiyor olacagim.

Thread sinifindan extend edilmis ve runnable sinifindan implement edilmis siniflar icerisinde run method’larina vermis oldugumuz komutlari, Test sinifinda olusturulan nesnelerin Start methodlari ile thread’leri cagiriyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

Thread Sinifi Method’larinin Kullanimi ve Uygulamalari

Gönderim Mayıs 31st, 2013

Aslinda her iki yontemle de ayni seyleri yapiyoruz fakat farkli iki yol kullaniyoruz. Thread sinifindan uretmis oldugumuz nesne sayesinde Thread yasam dongusundeki rolune tamamen hakim olmaktadir. Runnable ise bir arabirim gibi kullanilmaktadir. Sadece bir thread tanimlanir ve o thread uzerinde isler yurutulur fakat tum kontrole hakim olamaz. Diger onemli bir konu ise,

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

MultiThreaded Programming With JAVA

Gönderim Mayıs 31st, 2013

Java’da Thread’ler object olarak bulunmaktadir. Iki farkli yontemle thread’ler uzerinde calisabiliriz.

1. Standart sinifimizi Thread sinifindan extend ederek.

2. Standart sinifimizi Runnable interface’inden implement ederek.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Paralel Programlama, Sistem Programlama, Yazilim | Yorum Yok »

Oracle Java Cloud Service Uygulamasi

Gönderim Nisan 30th, 2013

Bir onceki Oracle Cloud Computing yazisinda bahsettigim gibi JDeveloper Oracle Cloud icin gelistirmis oldugu surumu olan Oracle JDeveloper 11g ( ile kucuk bir uygulama gelistirip bunu oracle cloud ortamina nasil deployment edecegimizi yazalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Bulut Bilisim, Java, Oracle, Web Programlama, Yazilim | Yorum Yok »

Oracle Cloud Computing Hakkinda

Gönderim Nisan 29th, 2013

Bulut bilisim konusundaki arastirmalarima devam ederken bu kez solugu Oracle Cloud Computing’de aldim. Bu makalem ve ilerleyen makalelerimde Trial versiyonu ile user tarafini pek yormayan bir yapidan bahsediyor olacagim. Daha cok Java Developer’larin ilgisini cekecek olan bu yapi gun gectikce kendini gelistirmeye devam ediyor.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Bulut Bilisim, Java, Oracle, Yazilim | Yorum Yok »

Selenium – Python,Ruby,Java ve CSharp Donusumleri

Gönderim Mart 30th, 2013

Selenium’un bize HTML formatinda hazirlamis oldugu test case’leri Python, Ruby, Java ve CSharp dillerinde kullanabilecegimiz test case’lere nasil donusturecegimizi inceleyecegiz. En bastan beri kullanmis oldugum ornek uygulama uzerinden gidelim ve donusumleri nasil yaptigimizdan adim adim bahsetmeye baslayalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Python, Selenium, TDD - Test Driven Development, Yazilim | Yorum Yok »

TDD – Selenium IDE

Gönderim Mart 30th, 2013

TDD hakkinda on bilgilerden sonra baslangic seviyesinde ki NUnit ve JUnit bilgilerini paylasmistim. Simdi sira geldi yurt disinda populer olan, Turkiye’de de kullanilmaya baslayan bir IDE’den bahsetmeye; Selenium IDE. Bu yazimda, avantajlari ve dezavantajlari olan bu IDE’yi inceliyor olacagiz. Oncelik olarak adresinden gerekli toturial ve eklentilere ulasabilirsiniz. Simdi detayli bir sekilde Selenium IDE’yi inceleyelim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Selenium, TDD - Test Driven Development, Yazilim | Yorum Yok »

Windows Azure Platformunda Java Uygulamalari

Gönderim Eylül 14th, 2012

Windows Azure’u bugune kadar aliskanlik olarak surekli Visual Studio ortaminda anlattik. Ilk baslarda dedigimiz gibi Windows Azure bircok platforma destek vermektedir. Peki .Net haricinde farkli bir dunya olan Java tarafinda isler nasil yuruyor bunlari arastirmak istedim. Bu makalemde Windows Azure platformunda Java’yi  inceledikten sonra yine her zamanki gibi basit bir uygulama ile noktamizi koyuyor olacagiz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Sistem, Web Programlama, Windows Azure, Yazilim | Yorum Yok »

Java Web Service ve Web Service Client Olusturma

Gönderim Mayıs 10th, 2012

Java Web Service ve Java Web Service Client olusturmalari ile ilgili bu uygulamayi adim adim gerceklestiriyor olacagiz. Uygulamamizda cektigimiz veriye ait diger bilgileri listelettirme islemlerini gerceklestiricez.

Bunun icin database’imizden verileri aktarabilmemiz ve yine bu verileri kullanicilara sunabilmemiz icin yine jsf yapisindan yararlaniyor olacagiz.

Oncelikle Netbeans arayuzumuzde Web_Service_Uygulamalari isminde  yeni bir web application olusturalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Sistem, Web Programlama, Yazilim | Yorum Yok »

JSP Servlet ile JSON Uygulamasi

Gönderim Mayıs 8th, 2012

Bu makalemde JSon yapisindan biraz bahsettikten sonra hemen ardindan Oracle veri tabaninda ki verilerimi Java’da Bean siniflari kullanarak web ortaminda JSP formati ile kullaniciya verilerimizi sunucam.

Oncelikle JSon’dan bahsedecek olursak…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Java, Oracle, Web Programlama, Yazilim | Yorum Yok »

Java – Assembly Derleyecisi

Gönderim Mayıs 8th, 2012

Asm komutlarini okuyup derleyebilen, hatali kodlarda kullaniciya hatali bilgi mesaji verebilen Java tarafinda gorsel arayuz kullanarak gelistirmis oldugumuz bir derleyicidir. Hashmap icin guzel bir ornek olabilecegini dusunuyorum…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Genel, Java, Yazilim | Yorum Yok »

JPA – Java Persistence API Kullanimi

Gönderim Nisan 7th, 2012

Bu makele ile birlikte NetBeans IDE ortaminda nasil rahat bir sekilde Java Persistence API kullaniliyor bunu anlatacagim.

Java Persistence Api’ler JPA olarak anilmaktadir. JPA en son olarak JPA2.0 olarak anildigindan dolayi icerisinde barindirdigi konular vardir. Bunlar ; API’nin kendi tanimlamis oldugu javax.persistence package’ , Java Persistence Query Language(LPQL), nesneler arasi iliskiler olusturmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Jsp ve Sevlet’da Bean Kullanim Uygulamasi

Gönderim Mart 22nd, 2012

Bu makelemde Jsp ile birlikte Servlet’leri kullanarak Veri Tabanimiza bilgi nasil ekleyip listeleyebilecegimizi basit bir uygulama ile anlatmak istiyorum.

Uygulama icin kullanacagimiz server; GlassFish Server V3.x olacaktir.

Hemen ardindan da Netbeans IDE derleyici ortaminda bulunan Services ortamina kullanacagimiz veri tabanini ekliyoruz veye olusturuyoruz.

Servlet icerisinde doPost metodunu override ederek islemlerimizi gerceklestiricez.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java’da Karar Agaclari – Linear Regression

Gönderim Ocak 23rd, 2012

Surekli degiskenlerin ongorusu regrasyon yani egri uydurma olarak adlandirilan bir istatistiksel yontemle tespit edilebilir. Regrasyon analizinin amaclari degisik girdi degiskenlerini cikti degiskeni ile iliskilendirecek en iyi modelin cikarilmasidir.

Bir Y degiskeninin diger bir veya daha cok X1, X2, … Xn, gibi degiskenleri ile iliskisinin belirlenmesi surecidir. Y , yanit ciktisi veya bagimli degisken olarak adlandirilir. Xi degiskenleri girdi ve bagimsiz degiskenler olarak adlandirilacaktir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Hibernate Uygulamasi

Gönderim Aralık 12th, 2011

Hibernate mimarisi daha onceki makalemde de bahsettigim gibi bir ORM araci olarak kullaniliyor. Object oriented’da bulunan nesnelerin veritabanlarinda ki iliskilerine karsilik gelen degerleri siniflandirabilecegimiz bir mimaridir. Bu mimarilerin en onemli faydasi, kod yazimini kisaltmak veya kolaylastirmaktan ziyade, yazilimin iyi bir sekilde dizayn edilmesi kolaylastirilmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da MVC, ORM, Hibernate Kavramlari

Gönderim Aralık 11th, 2011

MVC (Model View Controller)

Yazilim muhendisliginde kullandigimiz bir mimari yapisidir. Amac projelerimizde soyutlandirma yapabilmektir. Katmanlari paracalara ayirmaktir. Bol, Parcala, Yonet en bilinen amactir.

Bu modelin kullanilmasinin ihtiyac sebebi ise ; kalabalik bir tasarlanmis projeyi hem dizayn tarafindan hemde arka tarafdaki bazi kodlari tekrar tekrar yazdigimizda kod fazlaligi olusmaktadir. ilerki zamanlarda hata ciktiginda bunlari bulmak zaman alacagindan dolayi bu model gelistirilmis ve kullanilmaya baslamistir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java – Veri Madenciligi / SQL Viewer

Gönderim Aralık 8th, 2011

Bu uygulamamizda ODBC ile ayarladigimiz veri tabani dosyamizdan verilerimizi cekip sorgulamalarimizi yapicaz… Ayni zaman da null veriler varsa bunlari buldurtup kullanicidan veri girilip girilmeyecegini veya bu verilerin silinip silinmeyecegi hakkinda onay alacagiz.

Açık Veritabanı Bağlantısı (ODBC),

bir tür veritabanından (veri kaynağı) diğer tür veritabanına veri taşımak için kullanabileceğiniz bir teknolojidir. Bunun için doğru sürücüye gereksiniminiz vardır. Bu surucu ayarlarini da ODBC ayarlari ile yapmaktayiz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da 2D Grafik Dizanylari

Gönderim Aralık 7th, 2011

Bu makelemde; Java’da 2 boyutlu grafik dizaynlarinda hangi kutuphaneler ve hangi genel kullanisli komutlar var bunlari inceleyecegiz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Karar Agaclari – ID3 Algoritmasi

Gönderim Aralık 7th, 2011

Karar Agaçları, Temel sınıflandırma tekniklerinden biri olan karar agaçları; verileri belli nitelik degerlerine göre sınıflandırmaya yarar. Bunun için algoritmaya girdi olarak verilerin belirlenen belli nitelikleri, çıktı olarak da verilerin belli bir niteligi verilir. Algoritma bu çıktı niteligindeki degerlere ulasmak için hangi girdi nitelik degerlerinin olması gerektigini agaç veri yapılarını kullanarak kesfeder.

Karar agaçları, yaygın olarak kullanılan sınıflama algoritmalarından birisidir. Karar agacı yapılarında, her dügüm bir nitelik üzerinde gerçeklestirilen testi, her dal bu testin çıktısını, her yaprak dügüm ise sınıfları temsil eder. En üstteki dügüm kök dügüm olarak adlandırılır. Karar agaçları, kök dügümden yaprak dügüme dogru çalısır.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Data Access Object Pattern (DAO) ve UML Uygulamasi…

Gönderim Kasım 6th, 2011

Bircok programin var olma nedeni veriler uzerinde islem yapmak, verileri veritabanlarinda depolamak ve bu verileri tekrar edinmektir. Amac bu olunca, verilerin program tarafindan nasil veritabanlarina konuldugu ve tekrar edilnildigi onem kazanmaktadir. Data Access Objects(DAO) yardimi ile, kullanilan veritabanina erisim ve veri depolama, verilere erisebilme islemlerinin daha soyutlastirilarak, diger katmanlarin veritabanina olan bagimliliklari azaltilir. DAO ile diger katmanlar etkilenmede veritabani degistirilebilir. Kisacasi amac ; birbirini kullanan ama birbirine bagimliliklari cok az olan katmanlar olusturmak ve gerekli oldugu zaman bir katmani, diger katmanlar etkilemeden degistirebilmek olmalidir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | 1 Yorum »

Java’da Form Uzerindeki Tum Nesneleri Bir Dizide Toplama

Gönderim Kasım 4th, 2011

Bu uygulamamizda oyle bir dizi olusturuyoruz ki jFrame uzerinde ki tum nesneler algilayarak ve toparlayarak bir nesne icerisinde sakliyor.

Kod icerisindeyken Component turunde bir dizi olusturuyoruz ve icerisinde ki butun nesneleri aktariyoruz.

Sonrasinda ise ForEach blogumuz icerisinde ki InstanceOf ile component’in hangi nesneden olup olmadigini karsilastirip kontrol ettiriyoruz.



Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da JPanel Uzerinde Nesne Olusturma

Gönderim Kasım 4th, 2011

Uygulamamizda bir adet JButton ve JPanel kullaniyoruz.

Butonumuza tikladigimizda panel uzerinde diziye atmis oldugumuz yeni nesnemizden belirledigimiz sayida olusturacaktir.

Yani asagida olusturdugumuz kodlar sayesinde Butona tikladigimizda runtime aninda 20 adet textfield olusturacaktir ve bunlari panel uzerinde yapacaktir.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Birden Fazla Nesne Icin Olusturdugumuz Tek Event Ozelligi

Gönderim Kasım 4th, 2011

Bu uygulamamizda herhangi bir sekilde kendi adimiza kullanabilecegimiz bir event olusturuyoruz.

Bunu nesnelerinizin properties ozelliklerindeki event kisminda ActionPerformed’da bir isim vererek yapiyoruz.

Uygulama icerisinde butun butonlari secip properties’inde bulunan ActionPerformed event’ine isim veriyorum. Ve hangi butona tiklarsa tiklayayim referans olarak aldigi tek bir event’i calistiracaktir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da JSlider ile Gelistirilmis RGB Uygulamasi

Gönderim Kasım 4th, 2011

JSlider nesnemizin properties ayarlarinda en cok kullanilan maximum ve minimum ozellikleridir.

Bu uygulamamizda

RGB = Red, Green, Blue renk tablosunu

JSlider’larin yardimiyla JLabel in Opaque yani arka planin rengini yeniden yukleme ozelligini kullanmamiz icin bu ozelligi TRUE yapariz.



Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Timer ve Point Uygulamasi

Gönderim Kasım 4th, 2011

Bu uygulamamiz da ; JFrame icerisinde ekledigimiz bir adet JLabel’in koordinatlarini hesaplattirarak Timer nesnesi ile form uzerinde saga ve sola dogru gezinmesini saglayacagiz. Her nesnenin bir koordinati oldugu gibi JLabel’inda koordinatlari bulunmaktadir. Ilk koordinat JLabel ile formun solundan itibaren ne kadar oldugu ki bunu X olarak ifade edecegiz. Ikinci koordinatimiz da JLabel’imizin formun uzeerinden ne kadar uzakta oldugudur ki bunu da Y olarak ifade edecegiz. JLabel nesnesinin bir de genisligi vardir ki bunu da JLabel’ in Width ozelligi ile ifade ediyoruz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da Timer Nesnelerinin Kullanilmasi

Gönderim Kasım 4th, 2011

Java’da kullanilan iki timer ozelligi vardir. Bunlardan biri Awt kutuphanesinde bulunan Timer digeri de Java Swing kutuphanesinde bulunan timer ozelligidir. new Timer(1000,new TimerListener()) ozelligi ile kullanilan nesnenin her defainda bir event cagiracagi ve bu cagirilan event’in islerini kac ms’de yapacagini belirleriz. import javax.swing.Timer kutuphanesinide mutlaka eklemeliyiz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’da JComboBox ve JList Uygulamalari…

Gönderim Ekim 25th, 2011

Bu makalede JComboBox nesnesi ve JList nesnesi ile ilgili kucuk uygulamlari paylasiyor olacagim…

JComboBox nesnesinin veya JList nesnesinin properties ozelliklerinde model ozelliginin icerisinde listelerimizin icerisine istedigimiz bilgileri girebiliriz.

Veya bunlari sonradan komutlarla da ekleyebiliriz…



Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

JFrame Form Uygulamalari…

Gönderim Ekim 25th, 2011

Java Application tarafinda JFrame Form uygulamasi gelisterecegimiz bu makalemiz de olusturdugumuz form kismina ;

3 JTextField, 3 JLabel ve 1 JButton ekliyoruz…

Button uzerinde sag click olayinda sirasiyla

Events > Action > ActionPerformed kismini seciyoruz…

Ve butonumuzun icerisine komutlarimizi yaziyoruz ;



Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java’ da ActionListener Kullanimi…

Gönderim Ekim 19th, 2011

Yapacagimiz bu uygulama da ActionListener ozelligini kullanarak nesnelerimize olaylar olusturup bunlari nasil cagirabilecegimizi gorecegiz.

ActionListener Sinifi, Java.awt.event paketinin icinde bulununan bir interface’dir. Butonu tiklamak, checkbox’u isaretlemek gibi islemleri bu interface sayesinde yonetiriz.

ActionListener sinifi icerisinde actionPerformed metodunu barindirir. Bir ActionListener nesnesi yazdigimiz zaman bu metodu iptal etmemiz (override) gerekir.

C sharp bilenler için soyluyorum, C sharpta click_Event ne ise Java’ da da action listener icinde yazdigimiz metod da odur. Yani actionlistener,  bir nesnenin kullanıcı tarafından uyarıldiginda neler yapmasi gerektigini belirleyebilecegimiz metodları iceren interfacedir.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java Swing’te LayOut Uygulamalari…

Gönderim Ekim 19th, 2011

Birden fazla nesnenin form uzerinde gorunmesine layout manager sinifi ile yapiliriz.

Flowlayout ; nesneler normalde form uzerinde yan yana yerlestirilir. Form genisligi dolunca nesneler asagiya dogru kayarlar. Bu ozellikle bilrikte kullandigimiz properties’ler ise;

Alignmet : Nesneler nerden itibaren yerlesecegini belirtiriz.
Hgap ; horizantel nesneler arasinda yatayda ne kadar bosluk birakilacagini bildirir,
Vgap ; vertical nesneler arasinda dikeyde ne kadar bosluk birakacak belirtiriz…

Gridlayout : Formu satir ve sutunlara bolmeyi saglariz.
Rows ; satir sayisini belirler. Colmns sutun sayisini belirler. Ve Vgap – hgap olarak toplam dort tane deger alir.

Borderlayout ; frame i yada containeri asagi, yukari, sag, sol ve merkez olmak uzere 5 e boler… Nesneleri bu 5 bolgeye istedigimiz yere koyabiliriz… Class inda iki ozellik vardir onlarda vgap, mgap’tir… Jpanel birden fazla nesneyi bir arada tutmaya calisir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java ile Excel’den Veri Cekme

Gönderim Ekim 12th, 2011

Makale icerisin de; excel’den verileri cekebilecegimiz jxl.jar dosyamizin nasil import edildigi, ve gerekli jxl.jar dosyalarimizin nasil kullanilacagi hakkinda bilgi olmasi icin yazdigim kodlari paylasiyorum.

Diger kullandigim iki farkli ozelliklerden birisi; hashmap’le verileri cekip ayni veriden farkli girisleri sildirtip kacar tane girildigini yazdiriyorum. ikinci ise substring metodu ile string girilmis kelime yada cumlelerimizin sagdan – soldan nasil kelime cekebilecegimizi gosteriyorum.

Programin kodlari ve de ekran ciktisi asagida ki gibidir…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Excel’den Arff Formatina Donusumu Saglayan Program

Gönderim Ekim 12th, 2011

Veri Madenciligi programi Weka’da Excel dosyamizda ki tum bulunan verileri, arff (attribute relation file format) formatina cevirip, program icerisinde inceleyebilmemiz icin bir donusturme programi gerceklestiricez…

NOT : Bu program Suleyman Demirel Universite’sinde Bilgisayar Muhendisligi sinifi Veri Madenciligi dersi icin gelistirmis oldugum bir programdir…

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Veri Madenciligi – Weka Yazilimi…

Gönderim Ekim 7th, 2011

WEKA (Waikato Environment for Knowledge Analysis ), Yeni Zelanda Waikato Üniversitesi’nde gelistirilen bir veri madenciligi ve makine ögrenmesi yazılımıdır. WEKA yazılımı nesneye yönelik programlama dillerinden olan Java ile gelistirilmistir. Java birçok degisik ögrenme algoritmaları için düzenli bir platform saglamaktadır. WEKA’nın en güçlü özelligi birçok sınıflandırma teknigini içermesidir. Diger bir özelligi de uygulamaların komut girilerek gerçeklestirilmesine imkân tanımasıdır. WEKA programının genel kullanıcı ara yüzü yanda görülmektedir. WEKA programının genel kullanıcı arayüzü
WEKA’da; Preprocess (önisleme), Classify (sınıflama), Cluster (kümeleme), Associate (birliktelik kuralları), Select Attribute (nitelik seçme) ve Visualize (görsellestirme) panelleri  bulunmaktadır.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Yazilim | Yorum Yok »

Java’da Oracle Baglantilari Ve Uygulamalari…

Gönderim Eylül 8th, 2011

Bu makalemde java ile oracle arasinda ki iletisimi saglayabilmesi icin gerekli olan connection komutlarindan bahsedicem. Ve bunlari birer uygulama uzerinde anlaticam.

Konu Basliklarim soyle ;

– Tablolar da Sorgulama

– Parametresiz Kayit Ekleme

– Parametreli Kayit Ekleme

– Kayit Guncelleme

– Stored Procedure ile Kayit Ekleme / Guncelleme

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Oracle, Sistem, Yazilim | Yorum Yok »

JSP ile JDBC Baglantilari…

Gönderim Eylül 5th, 2011

Bu makalemde Jsp kodlari ile Veri tabanindaki tablolarimizdan bilgileri html ortamina aktaricaz. Bunun icin java’nin database’i olan jdbc’yi kullanicam. Veri tabani arayuzu olarakta MsSql’i kullanicam. Simdi hatirlatma amacli olarak baslica Jsp Etiketleri’nden bahsetmek istiyorum ;

Tanimlama Etiketleri ; Java degiskenlerini tanimlamak icin kullanilir ve <%! .. %> seklinde olusturulur.

Scriptlet Etiketler ; java ifadelerinden olusan kod parcalarini calistirmak icin kullanilir ve <% .. %> seklinde kullanilir.

Ifade Etiketleri ; butun java ifadelerini calistirmak icin kullanilir ve <%= .. %>seklinde olusturulur.

Bu etiketlerin disinda ; jsp sayfalari icinde yorum satiri olusturmak icin <%– .. –%> etiketlendirmesi kullanilir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Web Programlama, Yazilim | Yorum Yok »

Java’da MsSql’in ODBC Baglanti Ayarlari…

Gönderim Eylül 5th, 2011

Veri tabanimizi ve tablolarimizi olusturduktan sonra db’mizin java ile iletisime gecebilmesi icin Odbc ayarlarini kontrol etmemiz gerekir.

Odbc ayarlarimizi yapabilmemiz icin oncelikle sistemimizde ki; ODBC Data Source Administrator panelimize ulasmamiz lazim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Java, Sistem, Yazilim | Yorum Yok »


  • 4 Uye
  • 334 Yazi
  • 16 Yorum Var