Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

  • Bulundugunuz Sayfa: 
  • Ana Sayfa
  • DNA Cryptology Uygulamasi

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Bu uygulamayi java ortaminda gerceklestiyorum.

Dna bazlarindan Adenin ve Timin bazlari icin 0 bitini, Guanin ve Sitozin bazi icin 1 bitini kullanarak bit donusum islemlerine gelen dizilimi yonlendiriyorum. Gelen her bir bitin bir harfe donusturuldugunu asagidaki kodlarda da acik bir sekilde gorebilirsiniz.

Java Kodlari

public class DNA {

private String seq, harf, yeniKelime, harfDonustur, bitDonustur;
private int temp;

public DNA(String sequence)
this.seq = sequence;
for (int i=0; i<seq.length(); i +=5)
bitDonustur = donustur(seq.substring(i, i+5));
harfDonustur = cozumle(yeniKelime);

public String donustur(String kelime)
yeniKelime = “”;
for (int i=0; i<kelime.length(); i++)
if (kelime.charAt(i) == ‘A’ || kelime.charAt(i) == ‘T’) temp=0;
if (kelime.charAt(i) == ‘G’ || kelime.charAt(i) == ‘C’) temp=1;
yeniKelime = yeniKelime + temp;
return yeniKelime;

public String cozumle(String hecele)
if (hecele.equals(“00000”)) harf = “A”;  //0
if (hecele.equals(“00001”)) harf = “B”;  //1
if (hecele.equals(“00010”)) harf = “C”;  //2
if (hecele.equals(“00011”)) harf = “Ç”;  //3
if (hecele.equals(“00100”)) harf = “D”;  //4
if (hecele.equals(“00101”)) harf = “E”;  //5
if (hecele.equals(“00110”)) harf = “F”;  //6
if (hecele.equals(“00111”)) harf = “G”;  //7
if (hecele.equals(“01000”)) harf = “G”;  //8
if (hecele.equals(“01001”)) harf = “H”;  //9
if (hecele.equals(“01010”)) harf = “I”;  //10
if (hecele.equals(“01011”)) harf = “I”;  //11
if (hecele.equals(“01100”)) harf = “J”;  //12
if (hecele.equals(“01101”)) harf = “K”;  //13
if (hecele.equals(“01110”)) harf = “L”;  //14
if (hecele.equals(“01111”)) harf = “M”;  //15
if (hecele.equals(“10000”)) harf = “N”;  //16
if (hecele.equals(“10001”)) harf = “O”;  //17
if (hecele.equals(“10010”)) harf = “Ö”;  //18
if (hecele.equals(“10011”)) harf = “P”;  //19
if (hecele.equals(“10100”)) harf = “R”;  //20
if (hecele.equals(“10101”)) harf = “S”;  //21
if (hecele.equals(“10110”)) harf = “S”;  //22
if (hecele.equals(“10111”)) harf = “T”;  //23
if (hecele.equals(“11000”)) harf = “U”;  //24
if (hecele.equals(“11001”)) harf = “Ü”;  //25
if (hecele.equals(“11010”)) harf = “V”;  //26
if (hecele.equals(“11011”)) harf = “Y”;  //27
if (hecele.equals(“11100”)) harf = “Z”;  //28
return harf;

public static void main(String[] args) {
System.out.println(“1.Ornek : “);
System.out.println(“2.Ornek : “);

Ekran Ciktisi

1.Ornek :
2.Ornek :

Keyifli Calismalar Dilerim.

Etiketler: , , , ,
Bulundugu Konu Etiketleri Akademik, BioInformatic, Java, Yazilim |

Lutfen Yorumlarinizi Burdan Ulastiriniz!...

You must be Kullanici Adiniz : to post a comment.


  • 4 Uye
  • 334 Yazi
  • 16 Yorum Var