Nano'nun Günlüğü…

Ideallerimi gerceklestirmek icin arastiriyorum, Unutmamak icin yaziyorum!

PHP – CRUD Islemler Serisi 5

Gönderim Mayıs 20th, 2015

phpBir onceki PHP – CRUD Islemler Serisi 4 yazisinda view customer paneli uzerinde bulunan listenin hemen yan tarafindaki edit butonunun aktiflestirilmesi icin gerekli php komutlarindan bahsetmistik. Son olarak bu yazimizda ise, view customer paneli uzerindeki delete butonunun aktiflestirilmesi icin gerekli php komutlarindan bahsediyor olucaz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Php, Yazilim | 1 Yorum »

Satılık : Apple MacBook Pro

Gönderim Mayıs 2nd, 2015








Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Genel | Yorum Yok »

PHP – CRUD Islemler Serisi 4

Gönderim Nisan 20th, 2015

phpBir onceki PHP – CRUD Islemler Serisi 3 yazisinda view_customer.php paneli ile veri tabani uzerinde kaydetmis oldugumuz tum kayitlarin goruntulenmesini sagladik. Bu yazimizda ise, view customer paneli uzerinde bulunan listenin hemen yan tarafindaki edit butonunun aktiflestirilmesi icin gerekli php komutlarindan bahsediyor olucaz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Php, Yazilim | 1 Yorum »

PHP – CRUD Islemler Serisi 3

Gönderim Mart 20th, 2015

phpBir onceki PHP – CRUD Islemler Serisi 2 yazisinda index.php olusumunu ve ayni zamanda CRUD islemlerinden create yapisi icin insert sql cumleciginin nasil kullanilacagi hakkinda bilgilendirdik. Bu yazimizda ise, veri tabanina add customer paneli ile kaydetmis oldugumuz tum kayitlarin goruntulenmesini sagliyor olucaz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Php, Yazilim | 1 Yorum »

PHP – CRUD Islemler Serisi 2

Gönderim Şubat 20th, 2015

phpBir onceki PHP – CRUD Islemler Serisi 1 yazisinda Xampp icerisindeki PhpMyAdmin araci ile yeni bir veri tabani ve icerisine bir tablo olusturuyor olusturduk. Bu yazimizda ise index.php olusumunu ve ayni zamanda CRUD islemlerinden create komutunun kullanimi hakkinda bilgilendiriyor olucaz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Php, Yazilim | 1 Yorum »

PHP – CRUD Islemler Serisi 1

Gönderim Ocak 20th, 2015

phpBir onceki PHP – CRUD Islemler Serisi 0 yazisinda Php dosyalarinizin calisir hale gelebilmesi icin sisteminize Xampp control panelinin kurulumundan bahsetmistim. Bu seride ise Xampp icerisindeki PhpMyAdmin araci ile yeni bir veri tabani ve icerisine bir tablo olusturuyor olucaz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Php, Yazilim | Yorum Yok »

Nano’nun Günlüğü 4 Yaşında!

Gönderim Aralık 6th, 2014

happyBirthdayEvet tam dort yil olmus. 4 yil once sektorden bir dostumun tavsiyesiyle “neden bir blogun yok?” sorusu karsiliginda, icimdeki rahatsiz edici olmayan hafif bir tembel hissin cevabiyla “aman ya, ne ugrasicam!” diyordum, halbuki paylasim hissinin bu denli vazgecilmez bir sey olacagini kestiremiyormusum. Biricik ve degerli Abim, Selcuk GENC ‘ in de buyuk destekleriyle 4 sene once acilan blogumu biziklaya biziklaya bu gunlere getirebildim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Yazilim | Yorum Yok »

PHP – CRUD Islemler Serisi 0

Gönderim Kasım 20th, 2014

phpBu makale serisinde PHP ile CRUD islemlerinin yol gosterici olmasi bakimindan basit bir sekilde nasil gerceklestirildigine dair bir ornek uzerinden anlatilacaktir.

Ilk adim olarak oncelikle sisteminize PHP ve MySql admin panellerinin kullanimlari icin XAMPP Local Server kurmakla baslayabilirsiniz.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Php, Sistem, Yazilim | Yorum Yok »

Paralel Programlama – Faktoriyel Hesaplama

Gönderim Ekim 15th, 2014

parallel2-9 arasindaki sayilarin faktoriyelini ayri is parçaciklarina hesaplattirip sonuçlari master is parçaçigi tarafindan toplayan bir paralel program uygulamasini makale icerisinde paylasiyor olacagim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari C / C++, OpenMP, Paralel Programlama, Visual Studio, Yazilim | Yorum Yok »

Ogrencilere; Proje Raporu Hazirlama

Gönderim Ekim 1st, 2014

BooksEgitimin her alaninda mutlaka egitmenlerinize vermek zorunda oldugunuz yazili formatlar yani raporlar olacaktir. Bir rapor nasil olmali sorusuna en basit haliyle cevap olabilecek iki onemli icerigi bu makale icerisinde bulabilirsiniz. Yazilim veya sistem alanlarindaki Onlisans ve Lisans ogrencilerinin rahatlikla kullanabilecegi bir odev raporu semasi ve Yuksek lisans ogrencilerininde kullanabilecegi bir proje rapor semasini makale icerisinde inceleyebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Akademik, Bilgisayar Mühendisi, Genel, Seminer & Egitim, Yazilim | Yorum Yok »

MikroC – Seven Segment Sayac Uygulamasi

Gönderim Ekim 1st, 2014

cMikro C derleyicisi yardimiyla yazmis oldugumuz kodlarin .hex formatlarini proteus’taki devrelerimize gomerek uygulamalarin simulasyonunu gerceklestirmis oluyoruz. Bu makalemde sizlere Seven Segment ve Pic18F4550 devresini kullanarak bir sayac hazirliyorum. Sayaci 0 – 99 arasinda yukari veya asagi olacak sekilde saydirtabiliyor, ayni zamanda istege gore sayaci baska bir buton yardimiylada sifirlattirabiliyorum.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, Gomulu Sistem / Embedded System, Sistem, Sistem Programlama, Yazilim | Yorum Yok »

MikroC – LCD Display Uygulamasi

Gönderim Ekim 1st, 2014

cMikro C derleyicisi yardimiyla yazmis oldugumuz kodlarin .hex formatlarini proteus’taki devrelerimize gomerek uygulamalarin simulasyonunu gerceklestirmis oluyoruz. Bu makalemde sizlere LCD Display ve Pic18F4550 devresini kullanarak lcd ekrana mesaj gonderilmesi, mesajin ekran uzerinde kaydirilmasini, mesajin silinmesi ve baska bir mesajin yazilabilmesini uygulama uzerinde gosteriyor olucam.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, Gomulu Sistem / Embedded System, Sistem, Sistem Programlama, Yazilim | Yorum Yok »

MikroC – Kara Simsek Uygulamasi

Gönderim Ekim 1st, 2014

cMikro C derleyicisi yardimiyla yazmis oldugumuz kodlarin .hex formatlarini proteus’taki devrelerimize gomerek uygulamalarin simulasyonunu gerceklestirmis oluyoruz. Bu makalemde sizlere kara simsek tabiriyle bilinen 8 led’li Pic18F4550 devresiyle calisan bir uygulamayi taniyor olucam.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, C / C++, Gomulu Sistem / Embedded System, Sistem, Sistem Programlama, Yazilim | Yorum Yok »

Software Testing Mulakat Sorulari

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir.

Bu makalemde sizlere yazilim test uzmanligi alanindaki bilgilenizi test edebileceksiniz, ayni zamanda daha onceden hic duymamis oldugunuz bir kavram ile de bu ilginc basliklar arasinda karsilasabilir ve boylelikle kendinize bir arti daha katmis olabileceksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Mulakat Sorulari, TDD - Test Driven Development, Yazilim | Yorum Yok »

Java Mulakat Sorulari – İleri Seviye

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir.

Bu makalemde sizlere ileri seviye java bilgilenizi test edebileceksiniz, ayni zamanda daha onceden hic duymamis oldugunuz bir kavram ile de bu ilginc basliklar arasinda karsilasabilir ve boylelikle kendinize bir arti daha katmis olabileceksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

Java Mulakat Sorulari

Gönderim Ekim 1st, 2014

BooksIs verenler tarafindan sozlu mulakatlarda yada kurumun standart belirlemis oldugu yazili sinavlarda sizin programlama bilginizi olcebilecek bazi yetkinlik belirten sorular bulunmaktadir. Bu makalemde sizlere kendi yeteneginizide test edebileceginiz; nesne yönelimli programlama ve özellikleri, Java ve işlevselliğine ilişkin genel sorular, Java koleksiyonları, çöp toplayıcıları, istisna işleme, Java uygulamaları, Swing, JDBC, Uzak Metot Çağrımı (RMI), Servlet ve yaklaşık görüşecek JSP konularinda genel kultur olabilecek bazi mulakat sorular bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Bilgisayar Mühendisi, Genel, Java, Mulakat Sorulari, Yazilim | Yorum Yok »

IT alaninda Dizi, Film ve Belgesel Tavsiyeleri

Gönderim Eylül 30th, 2014

untBir cogunu bildiginiz ve sonrasinda cok sasiracaginiz ve hemen izlemek icin listelerinize ekleyebileceginiz yazilim, sistem ve IT alanindaki film ve dizileri bu makale icerisinde listeliyor olacagim. The It Crowd, Halt & Catch Fire, SwordFish, Revolution OS, Gamer, The Internship, Indie Game, Transcendence gibi orneklere ait konular ve trailer’lari makalemizden edinebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Genel, Yazilim | Yorum Yok »

Proteus Arduino Library

Gönderim Eylül 21st, 2014

arduinoTasarlamis oldugunuz Arduino projelerinizi bir cok simulasyon programlarinda calistirabileceginiz gibi Proteus programi uzerinde de arduino simulasyonlari yapabilirsiniz. Bunun icin, proteus’unuza arduino ile ilgili kutuphaneyi eklemeniz gerekmektedir. Simulasyonlarinizi proteus uzerinde uygulayabilmeniz icin, bir kac adimdan olusan bu islemleri ve proteus arduino library dosyasini bu makale icerisinde bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, Arduino, C / C++, Gomulu Sistem / Embedded System, Sistem Programlama, Yazilim | Yorum Yok »

Arduino ile Kriptoloji Uygulamasi

Gönderim Eylül 7th, 2014

arduinoArduino temel olarak acik kaynakli bir gelistirme platformuna sahip cevresiyle etkilesimli calisabilen sistemler tasarlayabileceginiz bir fiziksel programlama platformudur. Kullanici tarafindan girilen metinlerin nukleotid bazlarina donusturulmesi ya da girilen nukleotid dizilimlerinin metine donusturulmesini saglayan ve arduino uzerinde calisan bir sifreleme programidir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, Arduino, C / C++, Gomulu Sistem / Embedded System, Sistem Programlama, Yazilim | Yorum Yok »

Matlab ile Ses Sinyalleri Okuma

Gönderim Ağustos 31st, 2014

SigProcSes isleme, goruntu isleme gibi pek cok muhendislik alaninda calisanlar icin sinyal kavrami buyuk bir onem tasimaktadir. Bu makalemde var olan bir ses dosyasinin sinyallerini matlab ortaminda nasil okutabilecegimizi gosteriyor olucam.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Akademik, Matlab, Sinyal Isleme / Signal Processing, Yazilim | Yorum Yok »

Dans, Hareket ve Diyet

Gönderim Ağustos 28th, 2014

apple1Eeee saglikli yazilimcilar ne haldesiniz bakalim? Bir onceki yazimda sizlere hayatinizda basit bir sekilde uygulayabileceginiz tiyolardan bahsetmistim. Bu yazimda da Dans etmenin faydalari ve bunun icin atmaniz gereken ilk adimdan bahsederken bir de diyet paylasiyor olucam. Dans etmeyle araniz nasil bakalim? Peki ya yuruyusle? Sporla? Hadi biraz konusalim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Genel, Saglikli Yazilim Gelistiriciler | Yorum Yok »

Java ile Satranc Oyunu

Gönderim Ağustos 16th, 2014

javaBu makalede, Java’da oyun programlama yonunuzu gelistirebileceginiz bir uygulamanin kodlarini paylasiyor olucam.

Internet ortaminda da buna benzer bir cok oyun programlama orneklerini bulup kendinizini daha iyi bir sekilde gelistirebilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

PHP ile Basvuru Formu Uygulamasi

Gönderim Ağustos 12th, 2014

phpPhp komutlarini kullanarak sayfalariniz icin basit bir basvuru formu yapabilirsiniz.

Bunun icin gerekli olan php komutlarini ve ait olan sql cumleciklerini bu makale icerisine bulabilirsiniz. Html taglari icerisinde php komutlarinin nasil cagirildigina ve cagirilan php komutlarinin nasil kullanildigina dikkat edin.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: ,
Bulundugu Konu Basliklari Php, Yazilim | Yorum Yok »

Profile HMM (Hidden Markov Model)

Gönderim Temmuz 30th, 2014

Bu makalemde, Hidden Markov Model ‘in Biyoinformatikteki Yeri olan Profile HMM inceliyor olucaz. DNA dizilimlerinde genlerin tespiti biyo informatik alaninda halen zorlu ve ilginc bir sorun olarak bilinmektedir.

Bu kadar cok genomun cok hizli bir sekilde diziye girmesi, biyo informatikte gozlemlenecek tekniklere yol acmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Java Desktop App ile Local Sequence Alignment

Gönderim Temmuz 7th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in Java Desktop Application ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini ve java desktop application orneklerini iyi bir sekilde pekistirmis olabileceksiniz. Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Pattern Recognition Assignments II

Gönderim Haziran 27th, 2014

patregPattern Recognition – Oruntu Tanima alaninda calismaniz icin Maksimum olabilirlik kestirimi, Bayesian siniflayici, knn, kmeans, Gaussian parzen penceresi, RBF siniflayici konulari ornek niteliginde isinize yarayabilecek soru ve cevaplari bu makale iceriginde bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

Pattern Recognition Assignments I

Gönderim Haziran 26th, 2014

patregPattern Recognition – Oruntu Tanima alaninda calismaniz icin Mean Vector, Covariance Matrix, Med – minimum euclid distance, ozdeger, oz vektor ve standart sapma konulari ornek niteliginde isinize yarayabilecek soru ve cevaplari bu makale iceriginde bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

BioInformatic Assignments

Gönderim Haziran 17th, 2014

Biyoinformatik alaninda calismaniz icin ornek niteliginde isinize yarayabilecek soru ve cevaplari bu makale iceriginde bulabilirsiniz.



Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Matlab – CART

Gönderim Haziran 7th, 2014

matlabCART – Classification And Regression Trees (Siniflandirma ve regrasyon agaclari) olarak bilinen konunun bir dataset uzerinde calisilarak matlab komutlarinin yardimiyla nasil siniflandirma ve regrasyon yapildigina dair uygulamalara bu makale icerisinde ulasabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

C4.5 Algoritmasi

Gönderim Haziran 5th, 2014

patregID3 algoritmasinin gelistiricisi, ID3 algoritmasi sonucunda siniflandirmalarda bazi eksiklikler ve sorunlar tespit etmistir. Bu sorunlarin giderilmesini C4.5 algoritmasi ile saglamistir. Kokeni tamamen ID3 algoritmasi olan C4.5 algoritmasina gelen ek ozellikler bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

ID3 (Iterative Dichotomiser 3 – Tekrarlanan ikili yapi)

Gönderim Haziran 3rd, 2014

patregOzunde Entropy hesaplamasi kullanan bir algoritmadir. Entropy, bir veri kumesindeki verilerin belirsizliginin sayisallastirilmasi demektir.  Algoritmanin amaci, egitim kumesindeki verilerin agacin olusturulmasi esnasinda birbirine benzetilmesi gerekiyor, agac derinliginin minimum olmasi, karmasikliginda minimum olmasini saglarken kazancin maksimum olmasi gozle gorulur bir fark alacaktir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

CART (Classification & Regression Trees)

Gönderim Haziran 2nd, 2014

patregSiniflandirma ve regrasyon agaclari olarak bilinen bu modelin temelinde tek degiskenli ikili kararlarin bir hiyerarsisini icermektedir. Yaygin olarak kullanilan bu istatistiksel prosedur, verileri iki alt kumeye ayirmaktadir. CART agaclari kesin bir heterojenlige (impurity) sahiptirler ve bu heterojenlik iki degerli (binary) agaclar yardimiyla optimize edilerek homojen hale getirilmektedir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

Karar Agaclari

Gönderim Haziran 1st, 2014

patregKarar agaclari, Pek cok problemin cozumu icin veriler uzerinde istatistik analizleri onemli bir metodtur. Bazi durumlarda istatistik kullanimi sinirli oldugundan dolayi akilli veri analizi yontemlerini iceren algoritmalar ortaya cikmistir. Ancak bu yontemlerin bazilari zayiftir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

Java ile Multiple Sequence Alignment (4D)

Gönderim Mayıs 27th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (4 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | 2 Yorum »

Java ile Multiple Sequence Alignment (5D)

Gönderim Mayıs 26th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Multiple Sequence Alignment  (5 Boyutlu) ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Matlab Multialign

Gönderim Mayıs 21st, 2014

Biyoinformatik alaninda multi alignment islevini gerceklestirmeye yarayan multialign komutunun nasil kullanilacagi hakkinda bilgiyi makale icerisinden edinebilirsiniz. Ayni zamanda uygulamayi yaparken ilgili fasta file’larin icerikleride bulunmaktadir.


Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Java ile Local Sequence Alignment

Gönderim Mayıs 17th, 2014

Bu makalemde size biyo informatik alaninda cok sik kullanilan bir hizalama yontemi olan Local Sequence Alignment ‘in java ile kodlanmasi hakkinda basit bir uygulama paylasiyor olucam.

Yine ayni zamanda java uzerinde string kontrollerini pekistirmis olabileceksiniz.

Yazinin sonunda kullanabileceginiz birden fazla dizilim ornekleride bulunmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

CART : Classification And Regression Trees

Gönderim Mayıs 9th, 2014

matlabMatlab’ta CART : Classification And Regression Trees islemlerinin nasil kullanildigi hakkinda basit bir kac uygulamayi makale iceriginde bulabilirsiniz. Ayni zamanda CART : Classification And Regression Trees islemlerinde datasetlerin nasil cagirilabilecegi hakkinda da bilgi sahibi olabileceksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayarli Gorme / Goruntu Isleme, Matlab, Oruntu Tanima/ Pattern Recognition, Yazilim | Yorum Yok »

Java ile Protein Dizisi Hizalama

Gönderim Mayıs 5th, 2014

Bu makalemde basit bir mantikla protein zincirlerlerinde hizalamalari java yardimiyla eslestirmeye calisicaz.

Yapilan bu calisma ile ayni zamanda java’da string kontrollerini pekistirmis olucaksiniz.

Calisma sonucunda ornek olarak kullanabileceginiz protein dizilimleride bulabilirsiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java ile Blosum62 Hesaplama

Gönderim Nisan 25th, 2014

Biyoinformatik alaninda protein dizilerinin hesaplanmasi konusu onemlidir ve dikkatlice yapilmasi gerekir. Dizi hizalamanin en onemli gorevi farkli DNA, RNA veya protein dizilimlerinin birbirine en cok benzer alanlarinin tespit edilmesidir. Dizi hizalamarinda temel yaklasim olarak hesaplama islemleri puanlama sistemine dayanmaktadir. Bunun icin en cok kullanilan algoritmanin BLAST oldugunu soyleyebilirim. Yapmis oldugum uygulamada, en basit seklinde bir Protein diziliminin hesaplamasi icin BLOSUM62 yontemini kullaniyor olucaz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

DNA Cryptology Uygulamasi

Gönderim Nisan 3rd, 2014

Merhaba, bu yazimda sizlere cryptology alaninda DNA uzerinde basit bir uygulamasini paylasiyor olucam.

Yapmis oldugum DNA Cryptology uygulamasi icerisinde dna da bilinen A,T,G ve C bazlariyla olusturulan dizilimlerden nasil metinlere donusum yapilabilecegini gorucez. Ornegin ; AAGTATAGTGCATTATTGACCGAGGACGCTAACTGGTCAT diziliminin metinsel karsiligi DENEYLER‘dir. Nasil mi?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Java, Yazilim | Yorum Yok »

Java String Kontrolleri

Gönderim Nisan 2nd, 2014

java Bu yazimda sizlere java’da kullanilan bazi string kontrollerinden bahsediyor olucam.

Onceden belirlemis oldugunuz string’in belirli baslangic ve sonuc indexleri tanimlandiktan sonra string icerisinden o ifadeyi nasil cekebilecegimizi gorucez. Bu islemleri gerceklestirirken ornegimizde  indexOf ve substring kontrollerinin kullanisi hakkinda bilgi sahibi olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Java MySql Connection

Gönderim Nisan 1st, 2014

javamysql Bu makalerde, Java – MySql veri tabanina baglanti yapabilmek icin gerekli olabilecek java kodlarindan bahsediyor olucam.

Bu islemi yaparken sql cumlenizi baglantiyla ilgili metoda gondererek daha rahat bir sekilde yapabileceksiniz. Ayni zamanda try-catch blogunu kullanarak islem sureclerinde hataya yakalanip yakalanmadiginizi kontrol edebiliyor olacaksiniz.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Java, Yazilim | Yorum Yok »

Global ve Local Alignment

Gönderim Mart 21st, 2014

Hizalama turleri kullanilan algoritmalarina gore Global ve Local Alignment’lar olarak ikiye ayrilmaktadir.

Global alignment; Needleman & Wunsch algoritmasini kullanir.

Local alignment ise Smith & Waterman algoritmasini kullanmaktadir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, BioInformatic, Matlab, Yazilim | Yorum Yok »

Yazılım Geliştirici Yetkinlik Matrisi

Gönderim Mart 2nd, 2014

BooksBlogger Sijin Joseph’in bulusu olan, Programmer Competency Matrix ismi ile bilinen programci / yazilim gelistirici yetkinlik matrisi, bir nevi test gorunumu ile birlikte gelistiricilerin cesitli konularda programlama yetkinlikleri ve seviyeleri hakkinda bilgi sahibi olabilmelerini, durumlarini kisisel bir sekilde degerlendirebilmelerini saglayabilecekleri olcum tablosudur.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayar Mühendisi, Genel, Yazilim | Yorum Yok »

Saglikli Yazilim Gelistiriciler

Gönderim Şubat 25th, 2014

apple1Saglik ve Yazilimci ikisini bir arada olan bu terimleri surekli duyuyoruz. Ozellikle hastane bilgi yonetim sistemleri gibi cozum odakli yazilimlarda veya sirket isimlerinde… Peki biz yazilimcilar gercekten saglimiza onem veriyor muyuz? Bilgisayar basinda gecirdigimiz onca zaman hakkinda gercekten bir yigin haber yayinlanmis ve hemen hemen saglik sektorundeki herkesten ayni tavsiyeleri duyuyoruz, okuyoruz…

Peki bu tavsiyeler sadece hafizamizda gecici olarak mi kaliyor, neden uygulayamiyoruz?

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , ,
Bulundugu Konu Basliklari Genel, Saglikli Yazilim Gelistiriciler | Yorum Yok »

Karinca Koloni Algoritmasi Ile Kenar Tespit Yontemi

Gönderim Şubat 15th, 2014

Bu makalemde, karinca koloni algoritmasinin kenar bulmayla ilgili matlab kodlari, ekran goruntuleri ve basari sonuclarini inceleyebilirsiniz.

Bu calisma Yalova Universitesi – Fen Bilimleri Enstitusu – Bilgisayar Muhendisligi Ana Bilim Dali – Bilgisayarli Gorme dersi icin hazirlanmistir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayarli Gorme / Goruntu Isleme, Genel, Matlab, Yazilim | 1 Yorum »

Karinca Koloni Algoritmasi Nedir?

Gönderim Şubat 14th, 2014

Bu makalemde, karinca algoritmasindan bahsedikleten sonra, karincalarin sezgisel davranislarini matematigin olasilik formulleri ile incelenip, ilgili terimler hakkinda bilgi verilecektir. Sonrasinda Kenar tespit yontemleri hakkinda genel bilgi verildikten sonra, Karinca algoritmasi ile goruntuler uzerinde kenar tespit yaklasimini tartisiyor olacagiz. Bu calisma Yalova Universitesi – Fen Bilimleri Enstitusu – Bilgisayar Muhendisligi Ana Bilim Dali – Bilgisayarli Gorme dersi icin hazirlanmistir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayarli Gorme / Goruntu Isleme, Genel, Matlab, Yazilim | Yorum Yok »

Histogram Yogunluk Donusum Fonksiyonlari

Gönderim Ocak 31st, 2014

Makalede var olan bir image uzerinde bilgisayarli gorme – goruntu isleme konularindan histogtam bulma yontemi uzerindeki farkli gama ve logaritmic sonuclarini alicaz. Yazmis oldugumuz matlab fonksiyonlari ile elde ettigimiz goruntuler kodlari ile birlikte makale icerisinde olacaktir.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayarli Gorme / Goruntu Isleme, Matlab, Yazilim | Yorum Yok »

Biyolojik Isaret Isleme – Kan Basinc Olcumu

Gönderim Ocak 20th, 2014

Bu makalede, biyolojik isaret isleme’de onemli bir konu olan kan basinci olcumu, onemi ve olcum tekniklerinden bahsiyor olucam.

Bununla birlikte kan basinci ideal degerlerine, kan basinci olcumunun nasil yapildiginda, kan basinci olcumunde kullanilan devrelerden de bahsediyor olacagim.

Makalenin Devamini Okumak Icin Tiklayiniz!… »

Etiketler: , , , , , , , , , , , , ,
Bulundugu Konu Basliklari Akademik, Bilgisayar Mühendisi, Biyolojik Isaret Isleme, Genel | Yorum Yok »


  • 2 Uye
  • 334 Yazi
  • 16 Yorum Var